Cag promoter sequence pEASY-T1 Simple (linearized The CMV immediate enhancer/β-actin (CAG) promoter has been shown to give higher levels of transgene expression in several cell lines compared to the CMV and β-actin promoters . The Chicken beta actin contains a CpG island that can help to keep the promoter active for longer in stable culture when compared to the CMV promoter. 2, and the expression of GFP is driven by the compound promoter CAG. 1-1. The most commonly used promoter for ubiquitous expression of a transgene is the CAG promoter. The mouse PGK (mPGK) promoter is 551 bp long and is To elucidate principles operating in native biological systems and to develop novel biotechnologies, synthetic biology aims to build and integrate synthetic gene circuits within native transcriptional networks. pone. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. 12),50, 55, 56 the neuron-specific hSYN promoter, 51 the ubiquitous CAG promoter composed of the CMV early enhancer and the chicken β-actin (CBA) promoter We designed vectors for hKlotho overexpression (CA-Klotho) under control of CMV enhancer/chicken β-actin (CAG) promoter and Tet-inducible hKlotho overexpression (Tet-Klotho, under control of ATXN2 RAN translation was observed for ATXN2 sequences with 91 or 102 CAG repeats with C-terminal epitopes driven by the CMV promoter but not the native ATXN2 promoter. CAG promoter, which is a synthetic fusion of the CMV enhancer and the CBA promoter. CAG The CAG promoter, a combination of the CMV immediate early enhancer and the chicken β-actin promoter, has frequently been used to drive high-level gene expression in mammalian cells [Citation 32 – Citation 34]. Gain unparalleled visibility of your plasmids, DNA and protein sequences; Annotate features on your plasmids Promoter for bacteriophage T7 RNA polymerase. Fig. The promoter and enhancer sequences are listed in Figure S2. CAG promoter is known to be able to artificially induce high expression of target recombinant proteins in mammalian cells. Curr Biol. 1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer: LucNrev: CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer GenBank File: Plasmid sequence and annotations. pCAG-Hyg rIgG2b-Fc contains a rat IgG2b Fc region including hinge sequence at C-terminal part of multiple cloning site (MCS) and expresses Fc-fused proteins. IRES-dependent second gene expression is significantly lower than cap-dependent first gene expression in a bicistronic vector [ 21 ]. 16 The ChAT promoter showed 7-fold higher specificity of transduction of cholinergic neurons than the ubiquitous a much smaller promoter would offer greater versatility to allow the largest possible cargo sequences to be delivered. 2 blunt. If we know the TSS of a gene, we will know with confidence where the promoter is even without experimental characterization. Virus Production. Open in figure viewer PowerPoint. 19, 20 Prospective isolation of CAG low cells significantly enriched for reprogramming progressive cells in both mouse and human fibroblasts. 1, 2 In the brain, distinct cell types are often defined by the expression of unique gene ensembles, emphasizing critical roles for promoters and enhancers of these ensembles in determining cell identity and functionality. 2016 Apr 26;15(4):692-699. Promoter sequences are usually the sequence immediately upstream the transcription start site (TSS) or first exon. Plasmid pAAV-CAG-FLEX-oG-WPRE-SV40pA from Dr. NAR 23, 3816-3821 (1995)) obtained from Dr. The sequence underlined and bolded is the 3’ homologous arm targeting the cattle Rosa26. 0 knocked-in to Gt(ROSA)26Sor (Rosa26) locus with CAG promoter and stop sequence added between FRT cassettes. GenBank File: Plasmid sequence and annotations. org/41583/) for example. 42, 43 Other promoters, such as the human ubiquitin C (UBC) promoter 34, 44 and the ROSA26 promoter, 45 are also used In our library of CAG promoter variants, 51 are smaller than the original CAG, of which 22 are fewer than 1000 base pairs in length. See the sequence, map, and restriction sites of CAG promoter and its components in SnapGene. 41 However, some studies showed that the CAG promoter might cause non-ubiquitous or sometimes even silencing effects on expression of transgenes. However, the CAG promoter provided the highest levels of expression in all peripheral organs. SnapGene File: Plasmid sequence and SnapGene enhanced annotations. Promoters were cloned into either AAV or LV transfer vectors. Our work demonstrates that the inherent difference in A representative example is the CAG promoter, a combination of the CMV immediate-early enhancer and a modified chicken β-actin promoter . The activities of nine ubiquitous promoters (ROSA26, CAG, CMV, CMVd1, UbC, EF1α, PGK, chicken β-actin and MC1) have been quantified and compared in mouse embryonic stem cells. 108:193 C. We have tried Taq and Q5 polymerases, designed several new sets of The plasmid pAAV-CAG-iCasp9 was used as a donor plasmid, and the LP1 promoter was added in place of the CAG promoter along with a Kozak sequence (GCCGCCACC) upstream of the iCasp9 transgene to yield pAAV-LP1Kozak-iCasp9. Image: Illustrated plasmid map in PNG format. 3752. AAV backbone as well as eGFP sequences were obtained from Addgene plasmid #32396, the CAG promoter The hybrid CAG promoter is composed of sequences from the cytomegalovirus (CMV) immediate-early enhancer, the first exon/intron of the chicken β-actin gene, and the splice acceptor of the rabbit The main difference between CMV and CAG promoter is that the transgene expression of the CMV promoter is low, whereas the transgene expression of the CAG promoter is high. Pro from Dr. Two different vectors containing the CAG promoter were used. The CMV promoter originated from the immediate-early gene of human CMV did not contain the intron sequence , whereas the CAG promoter consisted of the same CMV immediate-early enhancer with a chicken beta-actin promoter and rabbit beta-globin intron . Plasmid sequence The plasmids expressing the Cas12a-nucleases used in this study were designed with a promoter (CAG, EF1a Core, CMV, PGK, for the detailed sequences see Additional file 1: DNA sequences) driven enAsCas12a-HF CDS, 3xHA, and a P2A-mcherry reporter, or a promoter (CAG, EF1a Core, CMV, PGK) driven dAsCas12a-HF CDS fusing with VP64-p65-Rta (VPR) Promoter Expression Level: The plasmid vector contains the mammalian CAG promoter which is a synthetic composite of the CMV immediate early enhancer followed by the CBA promoter and the rabbit beta globin intron. pSMART LCAmp (linearized) chicken beta-actin promoter. Title: pEMS1277_CAG_PCR_protocol_PUBLIC. The CAG-hACE2 mice showed several severe symptoms of SARS-CoV-2 infection, with definitive weight loss and subsequent death. Depositor. 4. CAG promoter inserted into pShuttle (CAG promoter = a combination of chicken beta-actin promoter and Plasmid pAAV-CAG-GFP from Dr. 42 Four promoters have been compared in MPS I mice: PGK, EF-1alpha, CMV, and the synthetic CE promoter (composed of the enhancer of the murine CMV immediate-early gene and human EF Lentiviral vectors containing promoters of distinct origins, that is, strong viral promoters (cytomegalovirus [CMV] and murine stem cell virus [MSCV]), a cellular promoter (phosphoglycerate kinase [PGK]), and two composite promoters (CAG [a composite promoter sequence comprised of the CMV enhancer and portions of the chicken beta-actin promoter . CMV and CAG promoters are used to The sequence colored in pink indicates the CAG Promoter. The LP1 promoter was replaced with the BIRC5 promoter to generate the pAAV-Birc5Kozak-iCasp9 vectors. amilRFP and copGFP were driven by cytomegalovirus 7 (CMV7) and elongation factor 1α promoters, respectively. promoters (EF1α, EFS, and UBC), one synthetic promoter (CAG), one mouse promoter (PGK), and one Chinese hamster promoter (CHEF1α) (Fig. 31, 32 The CAG promoter can drive strong gene expression in human and mouse ESCs and their derivatives, 33 whereas the activities of other constitutive promoters including CMV, UbC, EF1α and PGK gradually decreased during culture of human The CAG promoter is a composite promoter, connecting the CMV–IE enhancer sequence to the chicken β-actin promoter . Low endogenous SRF activity can be conveniently captured by a synthetic promoter, the CAG promoter which derives part of its sequence from the chicken actin promoter/enhancer. Due to the repeated CAG promoter sequences, a SpeI + EcoRI digest is recommended to The CMV immediate enhancer/β-actin (CAG) promoter has been shown to give higher levels of transgene expression in several cell lines compared to the CMV and β-actin promoters . The high prevalence of gene expression was maintained at 3, 7, 14 3. Plasmid pENTR221-CAG. The 5′ PCR junction is from The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore promoters play a large role in determining where and when your gene of interest will be expressed. Explore the Scientific R&D Platform Store, search, and share your sequences, files and maps; Download SnapGene Viewer. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used for cell selection. Nevertheless, it is still unsettled which promoter is to The CAG promoter used in the present system is an RNA polymerase II promoter and could be replaced by other RNA polymerase II-recognized tissue-specific or inducible promoters. To compare the performance of the CMV and CAG promoter in DRG neurons, titre-matched single-stranded AAV5 vectors expressing eGFP (Figures 1a CMV, CBh, and CBA promoters demonstrate distinct kinetics in cultured rat hippocampal slices. As expected, CAG provided a more robust and rapid expression of GFP in the mouse striatum with expression in neurons, astrocytes and oligodendrocytes. Furthermore, using the Myo15 promoter, we constructed an AAV-mediated therapeutic system with the coding sequence The vector’s insert includes a CAG promoter region, a loxP-flanked transcriptional termination (Lox-Stop-Lox; LSL) element and the Cas9 coding region linked to an IRES-GFP reporter element. 1016/j. 9 kb of genome capacity remained to package a transgene coding sequence in an scAAV vector. (A): A schematic illustration of AAVS1 gene targeting with the pAAVS1D-CMV. Use with SnapGene software or the free Viewer to visualize additional data and align other sequences. that the CAG promoter among three tested (CMV, EF1α, and CAG) achieved a high level of GFP expression in the striatum 334043848 - EP 2318537 A1 20110511 - OPTIMIZED PROMOTER SEQUENCE - [origin: WO2010015079A1] A modified CAG promoter which is capable of driving high levels of expression of sequences of interest inserted downstream therefrom is herein described. This could be a potential problem Conclusion: Vectors containing the CAG promoter offer a valuable tool for the long term expression of transgenes during stem cell differentiation towards mesoderm, while the CMV and β-actin promoters lead to very poor transgene expression during this process. See author's map for more information. After this step, only these ACE2-containing subreads were mapped to the mouse genome GRCh38/mm10 by minimap2. 1038/srep34365. AAVS1 targeting. (A) CMV promoter driven ATXN2 constructs including the ATXN2 ATG start codon expressed proteins as expected, detected on western blots by anti-HA (lanes 1 and 3) and anti-FLAG CAG Promoter PCR (pEMS1277) Expected product size (bp) 378 Reaction components Vol/Rxn Sequence. addgene. In this study, we sought to test the hypothesis that ultra-compact promoters derived from highly transcribed neuronal The CAG promoter showed the highest eGFP mRNA expression levels, followed by the HEF-1α, CMV mutation, and CHEF-1α promoters (Fig. With the TBG410 promoter, no differences were observed between the two administrations. In addition to the CMV immediate CAG promoter (AAV1 and AAV9 serotypes) We began our analysis by testing the CAG promoter. pShuttle is used to make adenovirus in the AdEasy system. 102904: GG-EBNA-EEA Accordingly, the Rosa-CAG-LSL-HA-DREADD-P2A-mCitrine targeting vector was designed with (from 5′ to 3′) a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a FRT site, a loxP-flanked STOP cassette (LSL; with stop codons in all 3 reading frames and a triple polyA signal), a hemagglutinin epitope tag (HA), the hM3Dq, hM4Di, and GsD sequence, The chicken b actin (CAG) promoter drove EGFP expression at the AAVS1 locus. Gain unparalleled visibility of your plasmids, DNA and protein sequences; Annotate features on your plasmids using the curated feature database CAG promoter. When eGFP was replaced with hepatitis B surface antigen, the CAG promoter still showed the highest transgene expression. Edward Boyden. Flp-mediated excision of the FRT-flanked stop cassette (Stop) induces PA-Cre Strong E. We generated AAV8 reporter vectors containing eGFP cDNA driven by the cytomegalovirus enhancer and chicken beta actin (CAG) hybrid promoter, GRK1 promoter, or human CAR promoter (Figure 1 A). This lacZ/STOP cassette was followed by EGFP as a second reporter gene. xls Author: ems Created The choice of the promoter or determination of a particular sequence included in the expression cassette was the subject of extensive analysis performed by Ou et al. 1 operably linked to a nucleic acid sequence comprising a Kozak sequence and a nucleic acid sequence encoding the codon-optimized Ebola virus glycoprotein as set forth in SEQ ID No. In HEK293T cells, 67 CAG promoter variants were found to be stronger than the original CAG with the strongest promoter exhibiting 13-fold improvement in potency. Transduction rates in the 90% range were achieved in many airways with the CAG promoter, showing that with the proper AAV capsid proteins and promoter sequences, efficient transduction can be achieved. CMV enhancer + chicken beta-actin promoter + chimeric intron The sequence of the promoter region controls the binding of the RNA polymerase and transcription factors, therefore promoters play a large role in determining where and when your gene of interest will be expressed. The eGFP mRNA expression levels were consistent with the protein expression levels, but the fold increase differed. CAG is a synthetic hybrid promoter, consisting of promoter elements from chicken β-actin promoter fused with enhancer elements from a cytomegalovirus (CMV) and a rabbit β-globin splice acceptor 64. The R segment and a part of the U5 sequence (R-U5′) of the HTLV type 1 long terminal repeat (LTR) were By using the 229-bp MeP promoter and a 49-bp synthetic poly(A) sequence (Levitt et al. All the promoters' sequences are included in Extended Data Fig. L 2 3 4 I-WT mouse DNA 2- Control p DNA 3- NO Template 4- n Esc line L- adder cted band size — - 384 bp . Gene. LOCUS 40924_38848 4801 bp DNA circular SYN 13-MAY-2021 DEFINITION recombinant AAV vector packaging self-complementary GFP under the CAG promoter. This extra packaging capacity could be critical for packaging therapeutic genes such as gigaxonin (1797 bp) for giant axonal neuropathy or tripeptidyl-peptidase I (1686 bp) for The cloned targeting vector contained a NeoR cassette, the human CAG promoter, and a translation interrupting LSL cassette linked with the dCas9-VPR gene fused to a self-cleaving P2A sequence and The activities of nine ubiquitous promoters (ROSA26, CAG, CMV, CMVd1, UbC, EF1α, PGK, chicken β-actin and MC1) have been quantified and compared in mouse embryonic stem cells. Sequence heterogeneity at the cagA promoter region. The CAG promoter is a strong synthetic promoter frequently used to drive high levels of gene expression in mammalian expression vectors. 1371/journal. The rationale of using a ubiquitous strong promoter relies on the idea of a single systemic delivery of gene therapy, which could target both the visceral With the CAG promoter, EGFP protein expression was 1. In summary, the new regulatory elements efficiently control gene expression in brain endothelial cells and may help to specifically target the blood-brain barrier with gene therapy The comparison of the bidirectional promoter variants relying on two different core promoters (variants ①–④) revealed that a CAG-type promoter (variant ①) supported high detector expression that was not matched by the PGK-type promoters with up to four PGK-enhancer elements (variants ②–④, Fig 4A–4D). pEASY-T3 (linearized) pJW168. 2016. O’Leary. The heterozygous hACE2 mice (ACE2-Tg) were crossed with Cars2 AINK The control promoters were the hepatocyte-specific hAAT promoter composed of the ApoE enhancer and the hAAT promoter, 94 the muscle-specific synthetic promoter C5. Perhaps, incorporating additional introns (the CAG promoter already contains an intronic sequence for enhanced expression) or exploring the CRISPRa split systems, including SunTag and SAM , to introduce as fragments and thereby minimize insert sizes, can be interrogated in future studies. 12, abbreviated as C5. In this transgene configuration, the CAG promoter first directs expression of the loxP-flanked chloramphenicol acetyltransferase (CAT) gene and polyadenylation sequence. The CAG promoter was used to replace the Myo15 promoter to construct the pAAV2-Myo15-GFP plasmid. The EF‐1α and CAG promoters (Fig. In addition, an IRES However, the CAG puromycin promoter is significantly less methylated than the CAG reprogramming promoter demonstrating differential methylation of the two sequence-wise identical CAG promoters The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon. pSMART LCAmp. This plasmid is available through Addgene. Use text editor or plasmid mapping software to view sequence. CAG promoter. D. Depositing Lab. My sequence is 68% GC rich and just over 1600bp long. A, Representation of the cagA promoter region, showing the location, type, and frequency of sequence variation observed in the −344, −53, −10, and +59 motifs of 46 Helicobacter pylori strains. A representative example is the CAG promoter, a combination of the CMV immediate-early enhancer and a modified chicken β-actin promoter . Saito I (Univ. e vector collection also features an empty control the EF-1a promoter, CAG promoter (a fusion promoter comprising a CMV enhancer, the chicken b-actin promoter and a rabbit b-glo-bin splice acceptor site) and CMV promoter mutants in the episo-mal vector and tested their transgene expression level and stability in CHO-K1 cells. Compared with the ubiquitous CAG promoter, the Myo15 promoter initiates efficient expression of the GFP fluorescence reporter in hair cells, while minimizing non-specific expression in other cell types of the inner ear and CNS. B, Confocal images of retina cross sections showing EGFP expression The features of this reporter strain are as follows: (1) EGFP is used as the reporter; (2) the ubiquitously strong CAG promoter is used to drive the reporter gene; (3) the reporter gene construct includes the loxP-flanked CAT gene sequence between the CAG promoter and the EGFP gene; (4) this reporter gene is switched on by Cre-mediated recombination. eCollection 2016. [origin: WO2010015079A1] A modified CAG promoter which is capable of driving high levels of The hybrid CMV/chicken β-actin promoter (CAG) promoter (Niwa et al. Browse a digital-only collection of vector backbone information. pEASY-T1 Simple (linearized) pJET1. (A): The top rows show the pAAVS1-CAG-EGFP construct, targeting site, and location of the 5 9 probe, which is the same A promoter is a DNA sequence that can turn gene transcription on or off. Introduction. CAG: General expression: mRNA: A list of sequencing primers that Addgene uses for sequence verification of deposited plasmids. Ralf Kuehn's lab contains the insert Rosa26 5-homology region and is published in BMC Biotechnol. Use text editor or plasmid mapping software to Provide pLVX-CAG-IRES-EGFP-Puro vector/plasmid map, full length sequence, antibiotic resistance, size and other information support @ novoprolabs. pSMART LCKan. CAG: CMV early enhancer fused to modified chicken β-actin promoter: Strong promoter. 2014 Aug;17(8):1123-9. I am also having this problem trying to amplify CAG promoter with intron. 2007 Jan 16;104(3) The coding sequence of Cre was amplified by PCR using pxCANCre (Kanegae et al. elegans pharynx and intestine in excess protein 1 promoter lacking repetitive sequences: Strong promoter; drives high levels of gene expression in all germ cells from the late L1 stage to the adult stage. Cre protein of bacteriophage P1, which is a 38-kDa protein , causes DNA recombination at loxP sites, each of which is 34 bp in length and comprised of two 13-bp inverted repeats flanking an asymmetric 8-bp core sequence, located within the mouse genome. 5‑fold higher with the use of IV injection than with IP injection. 4B). Plasmid MXS_BidirectionalCAG from Dr. In the absence of Flp recombinase, the frt-flanked transcriptional STOP sequence (FSF) located downstream of the CMV/chicken beta-actin promoter/enhancer (CAG) prevents the activation of the green The cause of the reduced promoter activity may be lower compatibility of the 121 promoter sequence Unstable expression of transgene is associated with the methylation of CAG promoter in the One of the challenges associated with constructing a transgene within scAAV genomes is their small cloning capacity. 13, 14 The human glucagon promoter is less well studied than the human insulin promoter and has been characterized mostly by sequence comparison studies with its rodent orthologs. Here, we compared the ubiquitous CAG promoter with two neuron-specific promoters, hSyn and CamKII, in the striatum of adult mice after intraparenchymal injection over the course of 6 months. The promoters were inserted into NdeI and EcoRI sites of pAM-AAV-CAG-EGFP-WPRE plasmid to replace the original CAG promoter but partially keep CMV enhancer. Individual Sequences & Maps. Its activity is equivalent to, or in some cell GenBank File: Plasmid sequence and annotations. 4,5 Moreover, the majority of clinical trials The DNA sequences of the micro-promoters (blue) originated from the human genomic insulin and glucagon promoter regions (green), respectively. Interestingly, the EF1 promoter exhibited the highest activation compared to the human cytomegalovirus (CMV) or CMV-enhanced chicken beta-actin (CAG) promoters as determined by flow cytometry and The most efficient expression (in terms of both mRNA and protein yields) was achieved using a cytomegalovirus (CMV) major immediate-early enhancer combined with the chicken beta-actin promoter (CAG) promoter, as compared to all other tested promoters under both transient and stable transfection conditions. ( How L1 vectors with different coding sequences and promoters, including pYX016 (CAG-ORFeus), pYX017 (CAG-L1 RP), pYX014 (5′-UTR-L1 RP) and pYX015 (5′-UTR-JM111), were evaluated in 24-well (Figure 4 A) and 96-well plates, respectively. 12 (spC5. CAG In order to determine whether the choice of promoter influenced the efficiency of T2A, the CMV promoter was replaced by a CAG prompter/enhancer. Please refer to the depositor's sequence for this region of the plasmid. Such Cre We began our analysis by testing the CAG promoter. -CAG-GFP-3xmiR122 is Ready to Package for the Transduction of the Endothelial Cells of CNS; AAV(9 PA-Cre 3. Contains a Hygromycin selection cassette. 2a). Store, search, and share your sequences, files and maps; Download SnapGene Viewer. , 1991), was the ~1700bp sequence cloned from pCAG-GFP, courtesy of D. The short CAG (sCAG) promoter is 868 bp long. doi: includes CAG promoter in itself. Edward Callaway's lab contains the insert oG (optimized Glycoprotein) and is published in Cell Rep. com +86-21-61941042 moters. Additionally, secretory In pfat-1, artificial promoter CAG simultaneously drives mRNA expressions of fat-1 and EGFP linked by IRES sequence . BlueScribe. To avoid the high variation in transgene expression which results from uncontrolled copy number and chromosomal position effects when using random insertion based Keywords: CAG promoter, Cre-reporter mouse, EGFP, Rosa26, tdsRed. However, whether highly compact promoters can drive cell-type-specific gene expression is still unclear. After excision of the loxP-flanked sequence by Cre-recombinase, the CAG promoter directs expression of the beta GenBank File: Plasmid sequence and annotations. CAG promoter is a hybrid construct consisting of the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter. Upon mating with CRE expressing mice, the termination box sequence can be removed by homologous recombination (HR) in select tissues, depending on the type of CRE mouse strains used. In conclusion, our data show that Comparison of promoters for gene expression in DRG. Epub 2014 Jul 6. Pekrun et al JCI Insight. pSMART LCAmp CAG promoter sequences were placed upstream of a loxP-flanked (floxed) STOP cassette containing a nuclear localized synthetic lacZ gene and a bovine growth polyadenylation (polyA) signal to ensure transcriptional termination. During the time of our experiments, the same dCas9-VPR Vectors containing the CAG promoter offer a valuable tool for the long term expression of transgenes during stem cell differentiation towards mesoderm, while the CMV and beta-actin promoters lead to very poor transgene expression during this process. In addition, we show that vectors containing either the RSV or CAG promoter expressed well in the nasal and tracheal epithelium. pii: 131610. The full CAG promoter sequence with a 5'-NheI restriction enzyme overhang For example, with the AAV serotypes rh43 and AAV8, enhanced Green Flourescent Protein (EGFP) expression under the control of a constitutively active, CAG promoter showed largely astrocytic PiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192 activator followed by T2A-EGFP as a reporter and IRES-Neo as selection EBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Despite this, several studies have demonstrated efficient neuronal targeting using a short ∼400 bp SYN1 promoter sequence 20, 22, 25 while Hb9 promoter enhancer elements 30 have never previously been tested in AAV delivery systems. If the transcription starts inside chimeric intron, there might be additional sequence added at the N-terminus of the gene under the control of the CAG promoter. The sequence colored in pink indicates the CAG Promoter. This could be a potential problem Four vectors that express enhanced green fluorescent protein (eGFP, 720 bp) under different promoters. B, Multiple sequence alignment of the cagA promoter, showing motifs that presented variation in this study. pEASY-T1 Simple (linearized) The common eukaryotic promoters include elongation factor 1α (EF-1α) promoter; CAG promoter , which is composed of CMV immediate-early enhancer, chicken β-actin promoter , and the splicing acceptor of rabbit β-globin ; phosphoglycerate kinase (PGK) promoter ; ubiquitin c (UBC) promoter; and tissue-specific promoters. Lentiviral vectors containing promoters of distinct origins, that is, strong viral promoters (cytomegalovirus [CMV] and murine stem cell virus [MSCV]), a cellular promoter (phosphoglycerate kinase [PGK]), and two composite promoters (CAG [a composite promoter sequence comprised of the CMV enhancer and portions of the chicken β-actin promoter and In addition to increased spread of transduction within the brain, we significantly increased AAV transduction selectivity and showed a trend toward greater efficiency of striatal cholinergic neurons in vivo by using the truncated human ChAT promoter. pEASY-T1 (linearized) pJET1. Our findings should benefit researchers the CAG promoter drove gene expression in the ES cells more efficiently than the (strongly silenced) CMV promoter, whereas the EF1a and the phosphoglycerate kinase (PGK) promoters showed much stronger transgene expression and were thereby claimed to be the promoters of choice for HuES cells. The promoter sequence was generated by deleting 829 base pairs using restriction enyzmes Eco47!ll and Xbal, filling the ends with Klenow and then religated the vector carrying the CAG promoter sequence with T4 Ligase, as If the transcription starts inside chimeric intron, there might be additional sequence added at the N-terminus of the gene under the control of the CAG promoter. celrep. the third strategy is to introduce an exogenous promoter or enhancer (such as CAG promoter) to drive high transgene expression (Figure c). The sequence underlined is the sequence of the 5’ homologous arm targeting the cattle Rosa26. Mark Kay. amilRFP-EF1α. Chicken version is commonly used in promoter hybrids. Matsuda et al Proc Natl Acad Sci U S A. GenBank File: Plasmid If the transcription starts inside chimeric intron, there might be additional sequence added at the N-terminus of the gene under the control of the CAG promoter. (2016). However, the "CAG promoter" is not a promoter in a strict sense, as it includes a part of the transcribed sequence (two exons and an intron) and enhancer elements. 1186/s12896-016-0234-4. Please note: Addgene NGS is unable to fully resolve the CAG promoter sequence. of Tokyo) as a Human cytomegalovirus (CMV) immediate early enhancer and promoter. The CAG promoter was inserted for stronger expression and a MCS compatible with pBS. When tested in mice, the regulatory sequences C-Ocln-W and C-Slc2a1-S-W enabled a stronger and more specific gene expression in brain endothelial cells than the frequently used CAG promoter. Open in a separate window. Rat hippocampal slices were infected with 5 · 10 7 VG after 7 days in culture, and GFP expression was Strong E. CAG is a synthetic hybrid promoter, consisting of promoter elements from chicken β-actin promoter fused with enhancer elements from a recombinant AAV vector packaging single-stranded Firefly Luciferase under the CAG promoter (includes WPRE element) Depositing Lab. Subretinal Cre-mediated recombination in the transgenic mouse. 15, 16 MP-135 is 135 bp long and These promoters include CAG (hybrid promoter consisting of CMV enhancer, chicken beta-Actin promoter, and rabbit beta-Globin intron), CMV (cytomegalovirus), SV40 (simian vacuolating virus 40), and Although the temperature sensitivity of the CMV promoter is greater than that of CAG promoter, recombinant protein levels were still highest when expression was driven by the CAG promoter. Gain unparalleled visibility of your plasmids, DNA and protein sequences; Annotate features on your plasmids using the curated feature database; CAG promoter. The CAG promoter has frequently been used to drive high-level gene expression in mammalian cells. One such composite promoter, CAG, consists of the CMV enhancer fused to the promoter and first intron of chicken (or human skeletal) β-actin. To avoid the high variation in The CAG-hACE2 mice are transgenic mice expressing human ACE2 driven by CAG, a promoter for strong and ubiquitous expression 30. Chuong et al Nat Neurosci. Described herein is an expression cassette comprising an optimized CAG promoter sequence (SEQ ID No. 3, 4 In research settings, promoters are vital tools used to drive targeted We tested two promoters, the conventional CMV enhancer/immediate-early promoter (CMV) and the hybrid CMV enhancer/chicken β actin promoter (CAG) in conjunction with the mRNA post-transcriptional regulatory element of the woodchuck hepatitis virus (WPRE) by generating four DNA vaccine constructs: pCMV-HA, pCMV-HA-WPRE, pCAG-HA, and pCAG GenBank File: Plasmid sequence and annotations. The R segment and a part of the U5 sequence (R-U5′) of the HTLV type 1 long terminal repeat (LTR) were The full-length 1800 bp-long CAG promoter is extensively used in retinal research [29, 88, 112,113,114,115,116] which was expected as the promoter sequences are alike, but the sCAG promoter Constitutive promoters are used routinely to drive ectopic gene expression. The choice of using the CAG promoter sequence to achieve a full-body gene expression is clinically relevant, as it is included in onasemnogene abeparvovec and is currently used in several other clinical trials. A representative example is the CAG promoter, a combination of the CMV immediate-early enhancer and a modified chicken b-actin promoter [8]. This could be a potential problem The elements of the pAAV2-Myo15-GFP plasmid contained the CDS of GFP, AAV2 ITRs, the Myo15 promoter, the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and the bovine growth hormone polyadenylation sequence (PolyA). The commonly used CAG promoter is usually labeled as three parts, take pCAGGS-mCherry (https://www. The primers used for PCR with the promoters are shown in Extended Data Fig. Connie Cepko. Explore the Scientific R&D Platform. Our study also clearly demonstrated that CAG promoter drove Tg expression ubiquitously at the highest level in EBs and ES-derived neurons without detectable epigenetic silencing, consistent with the report by Jakobsson et al. The sequence colored in yellow indicates the PGK-NEO-polyA casstte used In dramatic contrast to the commonly used universal CAG promoter, which drives EGFP expression in both GCL and inner nuclear layer The promoters' sequences are in Extended Data Figure 1-1 and the primers used to generate these promoters are in Extended Data Figure 1-2. CAG–GFP uses the backbone of pCLNCX v. Individual The CAG promoter is a well‐known synthetic promoter that provides efficient and stable gene expression in a variety of cell types. AAV-mediated expression of Cre under the CAG promoter . L1 activities are expressed as NLRs relative to the background signal from pYX015, and are graphed as a scatter plot. 2016 Jan 16;16(1):4. Vector Database. copGFPpuro donor. Edward Boyden's lab contains the insert GFP and is published in Unpublished This plasmid is available through Addgene. Includes PGK-puro selection cassette. Plasmid pR26 CAG/GFP Asc from Dr. , 1989), approximately 1. 2019 Nov 14;4(22). Publication. 0155177. Mouse phosphoglycerate kinase 1 promoter. The R segment and a part of the U5 sequence (R-U5 0) of the HTLV type 1 long terminal repeat Abstract. CAG-CAT-Z expression construct. Plasmid sequence and annotations. Under baseline conditions, that is without Cre Plasmid sequence and annotations. 067. CAG promoter was constructed in the lab of Dr Jun-ichi Miyazaki from the following sequences: (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, (G) the splice acceptor of the rabbit beta-globin gene CAG promoter (chicken beta-actin promoter with CMV enhancer) is more efficient than CMV promoter, see "Efficient selection for high-expression transfectants with a novel eukaryotic vector", Gene. 1C,D). 03. CAG was previously shown to induce high levels of gene Using CAG promoter in lentiviral vectors: Significantly reduced packaging efficiency and viral titer: Using same promoter to drive two genes in lentiviral vectors: Frequent recombination between promoters leading to deletion of sequence between promoters: Pol II promoter used to drive small non-coding RNA expression: Failure of transcription The short sequence immediately upstream of the TATA box contains predicted binding sites for the transcription factors PDX1 and PUR-1. Two CAG promoter variants, based on improved in S2 File: The whole nucleotide sequence of the Rosa26-CAG-EGFP vector. 1 ), shown in Figure 1. This vector also contains the woodchuck hepatitis virus posttranscriptional element, which reportedly increases protein Store, search, and share your sequences, files and maps; Download SnapGene Viewer. The promoter sequence is a crucial DNA regulatory element in the viral vector genome that determines the level of transgene expression as well as tissue specificity. It has been used for >30 years and a number of gene therapies have made use of this promoter to achieve a high vector expression ( 22 , 23 ). Use text editor or plasmid mapping software to view sequence The short CAG (sCAG) promoter is 868 bp long. 1-2. In addition, splice acceptor and polyA elements were placed upstream of the CAG promoter for the termination of the endogenous Rosa26 transcripts (Fig. In conclusion, these findings demonstrated that the CAG promoter was much more efficient at driving gene expression in the liver Intralumenal transduction of rabbit carotid arteries by an AAV2 vector containing a CAG promoter resulted in gene expression in a mean of ≥80% of the lumenal area at 14 days following exposure, compared to ≤25% gene-expressing area with the RSV promoter-based control vector. Mammalian expression of Cre recombinase from the broadly active CAG promoter/enhancer Depositing Lab. Both Simian virus 40 (SV40) enhancer and early promoter, with the SV40 origin of replication. Peter Jon Nelson's lab contains the insert CAG Promoter and is published in Sci Rep. 2. 1038/nn. Here, we carried out a systematic comparison of eight commonly used constitutive promoters (SV40, CMV, UBC, EF1A, PGK and CAGG for Analyze a DNA sequence to see restriction sites and map. In the In the present study, we established an animal model highly susceptible to SARS-CoV-2 via the intratracheal tract infection in CAG promoter-driven human angiotensin-converting enzyme 2-transgenic (CAG-hACE2) mice. Retroviral vector contains CAG promoter , CMV enhancer and a large synthetic intron that used to allow the ubiquitous Store, search, and share your sequences, files and maps; Download SnapGene Viewer. Pierre Neveu's lab contains the insert Bidirectional CAG Promoter and is published in PLoS One. 1991 Dec 15;108(2):193-9. 18:1476 (2008) If the transcription starts inside chimeric intron, there might be additional sequence added at the N-terminus of the gene under the control of the CAG promoter. doi: 10. The findings led us to conclude that TFREs CEBP, GATA Next, using minimap2 2. 2016 May 6;11(5):e0155177. To achieve directional cloning, The CAG promoter did not contain CEBP and GATA TFREs, and the CMV promoter did not contain GATA TFREs. Background Mouse embryonic stem (ES) cells are derived from the Rhodopsin K and Cone Arrestin Promoters Display Robust Activity in Photoreceptors but Poor Transgene Expression in Cell-Based Systems. This could be a potential problem GenBank File: Plasmid sequence and annotations. Abstract. The human CMV (hCMV) promoter has a size of 752 bp and is upstream of a 400 bp β-globin intron. The sequence colored in green indicates the EGFP gene. 2. A nucleotide sequence comprising the CAG promoter sequence as set forth in SEQ ID No. and share richly annotated sequence files. The first, pCAGIPuro is a bicistronic vector, where a puromycin resistance gene follows the IRES element. microRNA reporter relying on a bidirectional CAG-based promoter. coli promoter, a hybrid between the trp and lac UV5 promoters. Human CMV immediate early promoter, forward primer: LKO. 2016 Oct 3;6:34365. S1D) were generated by polymerase chain reaction (PCR). 5′F/5′R and 3′F/3′R primers were used for 5′ and 3′ junction polymerase chain reaction (PCR) screening. 27 , we mapped all extracted subreads to the sequence of the SalI-StuI fragment from pCAGGS-P7-hACE2 as an integrated hACE2 reference sequence with a CAG enhancer/promoter and poly A signal region. qcptu ntyj gmy yspm zbc jamjt apsjbxu ktog wlksc ggk